Skip to main content

Table 1 the primers used for qRT-PCR

From: Effect of ligustrazine nanoparticles on Th1/Th2 balance by TLR4/MyD88/NF-κB pathway in rats with postoperative peritoneal adhesion

Gene Primers sequence
TLR4 F 5′-3′ TGAATCCCTGCATAGAGGTA
R 5′-3′GACCGTTCTGTCATGGAAGG
MyD88 F 5′-3′GTAGCCAGCCTCTGAAAC
R 5′-3′AGCCAGGATGATGTCTAC
NF-κB F 5′-3′AGTTGAGGGGACTTTCCCAGGC
R 5′-3′GATTCGAGTATTAGTTCATGGA
β-actin F 5′-3′TCCTCACTGAGGCCCCGC
R 5′-3′CTGCCCCATGCCATTCTC